Quantification and standardization BGJ398 order was performed as described [20]. Briefly, linearized plasmids containing the genes of interest were used as standards. Therefore, the amounts of plasmids were determined using absorbance at 260 nm and the basepair count of the respective plasmids. A standard dilution series of the plasmids in water as well as in PBMC cDNA was routinely performed

for every primer pair/gene of interest. Values given represent the mean values (±SD) of at least two independent experiments performed in triplicates. Statistical analysis of the experimental data was performed using the Student’s t test and values of P < 0.05 were considered statistically significant. Oligonucleotide primers used (sequences from 5′-end): ß2-microglobulin-forward: GATGAGTATGCCTGCCGTGTG, ß2microglobulin-reverse: CAATCCAAATGCGGCATCT, DECTIN-1-forward: ACCATGGGGGTTCTTTCC;

DECTIN1-reverse: CCATGGTACCTCAGTCTG; CLEC-1-forward: GGGGGCTTTTGTTTTTTC; CLEC-1-reverse: GCTTTGTTATACAGCTCACG; CLEC-2-forward: GGATTTGGTCTGTCATGC; CLEC2-reverse: GCAGTACTGCTTACTCTC; LOX-1: GCATGCAATTATCCCAGG; LOX-1-reverse: GCTACTCTCTTCAGTGTTT; CLEC9a-forward: TGGAGCATTTGGCACACCAG; CLEC9a-reverse: CAACCCCACCCAGTAATCATAGC; GABARAPL-1-forward: TGTCAACAACACCATCCCTCC; GSK1120212 chemical structure GABARAPL-1-reverse: CTTCCAACCACTCATTTCCCATAG; CLEC12b-CTLD1-forward: TGAGGAGAAAACCTGGGCTA; CLEC12b-CTLD2-reverse: GCCAGAGGAGTCCCATGATA; CLEC12b-deletion-stalk-forward: TGGGGATGATGTTTTTGCAG; CLEC12b-insertion-CTLD2-reverse: TCCATGGAAAGCTTGTGTTT. The plasmids used for standardization were as follows: expression plasmids for DECTIN-1 Wilson disease protein and CLEC-1 were described previously [14], plasmids containing cDNA of CLEC12b (clone IRAKp961A2448Q2), FLJ31166 (clone HU3_p983D11229D2) and GABARAPL-1 (clone IRATp970E1244D6) were purchased from RZPD (Berlin, Germany). cDNA of CLEC-2 and CLEC9a was amplified from cDNA of PBMC using RT-PCR using primers CLEC-2 complete-forward GCAAAGTCATTGAACTCTGAGC and CLEC2-complete-reverse TCCTGTCCACCTCTTTGCAT, and CLEC9a-complete-forward ATGCACGAGGAAGAAATATACAC and CLEC9a-complete-reverse TCAGACAGAGGATCTCAACGC, respectively, and cloned into

EcoRV-digested pZErO™-2 (Invitrogen). The human NK receptor complex spans a region of approximately 2 Mb on the short arm of the human chromosome 12 (12p12.3-p13.2) [21, 22], whereas the syntenic region in mice is located on chromosome 6 (6qF3) [23] and in rats on chromosome 4 (4q42) [24]. In cow and dog, sequences of the genes encoded in the human complex can be aligned to chromosome 5 and chromosome 27, respectively. To shed more light on the evolutionary relationship between these regions in different species their genomic organization was investigated focusing specifically on the comparison between human and murine sequences of the myeloid cluster extending from the MICL (CLEC12a) gene on the telomeric side to the CD94 gene on the centromeric side.