After washing five times with PBST, 100 μl detection antibody:HRP conjugate (diluted 1:250 in PBS with 10% heat-inactivated FBS)

was added to the wells and incubated for 1 h at room temperature. After extensive washing (seven times using PBST), 100 μl of H2O2/3,3′,5,5′-tetramethylbenzidine prepared according to the manufacturer’s instructions (TMB substrate reagent set, BD Biosciences) was added to each well selleck products and incubated at room temperature for 30 min in the dark. The reaction was stopped with 2 N H2SO4 and absorbance read at 450 nm using a Multiskan MS plate reader (Labsystems). selleckchem Difference between means was tested statistically by using the Student’s t-test, with the limit for statistical significance set to p-values < 0.05. Quantitative polymerase chain reaction Total RNA was extracted using the Nucleospin RNA II Kit (Macherey-Nagel) with a DNase treatment step. cDNA was synthesized from 1 μg of extracted total RNA using qScript cDNA Synthesis Kit (Quanta Biosciences). Quantitative real time PCR was performed using Perfecta SYBR Green Fastmix on a Stratagene MX3000 QPCR system (Agilent Technologies) according to the manufacturer's instructions. Primers were designed to bind to different exons within the

genes thereby Gefitinib ic50 avoiding risk of genomic DNA amplification. The primers had a Tm = 60°C with the following sequences: GAPDH: 5′ CCGTCTAGAAAAACCTGCCA 3′ and 5′ TGTGAGGAGGGGAGATTCAG 3′; TLR4: 5′ CTGAGCTTTAATCCCCTGAGGC 3′ and 5′ AGGTGGCTTAGGCTCTGATATGC 3′. All reactions were run in triplicate. Results were analyzed using MxPro QPCR software (Agilent Technologies) and statistics were performed on adjusted ratios using a non-parametric Mann-Whitney U test.

The limit for statistical significance was set to p-values < 0.05. Immunoblot Cells were grown and challenged as previously described in a six-well format, and thereafter SPTLC1 lysed using RIPA buffer. Immunoblotting of cell lysate onto a PVDF membrane (Amersham Biosciences) was performed using vacuum. Unbound PVDF sites were blocked with blocking buffer (Tris-buffered saline, TBS, containing 0.05% Tween-20 and 1% BSA) for 1 h. Blotted membrane was incubated in primary antibody solution (anti-TLR4, clone HTA125; BD Biosciences or anti-β-actin, clone AC-15; Sigma-Aldrich) resuspended in blocking buffer at a concentration of 1 μg/ml (anti-TLR4) or 10,000 times dilution (anti-β-actin) for 1 h at room temperature and thereafter washed 3 times for 5 min in wash buffer (TBS and 0.05% Tween-20). For visualization, the membrane was incubated with the secondary antibody (anti-mouse IgG HRP-conjugated, GE Healthcare) at a 10,000 times dilution for 1 h in room temperature. The membrane was washed 4 times for 5 min using wash buffer before the addition of chemiluminescent substrate (Supersignal west pico, Pierce).